(M0930-03-19) Identifying the Targets of Ocular Tissue-Targeting RNA Aptamers by Proteome Integral Solubility Alteration (PISA) Assay

Purpose: Our previous studies have shown that short, synthetic nucleic acid molecules called RNA aptamers selectively bind to ocular tissues after systemic and local administration [1,2]. RNA aptamers could be used to target drugs to ocular tissues and improve the treatment of eye disorders, extending the dosing intervals and offering a patient-friendlier alternative to the current standard of intravitreal injection. In this study, we aim to identify the ocular targets of our previously selected RNA aptamer using the recently developed Proteome Integral Solubility Alteration (PISA) assay [3]. PISA is a high-throughput, mass spectrometry-based proteomics method that identifies drug targets by detecting protein solubility changes induced, for example, by heat treatment.

Methods: The aptamer used in this study had a molecular weight of 26 kDa and the nucleotide sequence 5′-GGGGCCACCAACGACAUUUUGACUGAAUACGCACAUUCGCCAAAUUGCCGGCCC GUUGAUAUAAAUAGUGCCCAUGGAUCCGCGGGUGUCGGG-3′. One Long-Evans rat eye was homogenized using a Bead Ruptor Elite homogenizer (Omni International, Georgia, US) and centrifuged at 4°C for 5 min at 11000 rpm. The supernatant was collected, and the protein concentration was measured using the Bradford assay. The eye tissue homogenate was diluted to 4.5 mg/mL and then incubated at 37°C for 30 min with and without aptamer. After that, samples were divided at equal amounts into a PCR plate and subjected to a 3 min thermal treatment at 10 different temperatures (43.9, 44.9, 46.5, 48.5, 50.5. 52.5, 54.5, 56.5, 58.1 and 59.1°C), followed by 6 min incubation at room temperature. Equal aliquots of each temperature were combined, and P40 detergent was added to final concentration of 0.4 %. Incubation was performed at 4°C for 1 h at 350 rpm, followed by ultracentrifugation at 4°C for 30 min at 149 000 g. Trypsin/Lys-C  mix was used to digest proteins overnight at room temperature.  Analysis was performed by LC-ESI-MS/MS on Evosep One (Evosep, Odense, Denmark) coupled to TimsTOF fleX (Bruker, Bremen, Germany) mass spectrometer equipped with CaptiveSpray nano-electrospray ionization source. Each sample was injected three times as technical replicates, and they were analyzed by data independent acquisition (DIA) method. Data analysis including protein identification and quantification of protein abundances was carried out by Spectronaut (Biognosys; version 19.4) software utilizing Rattus protein sequence database. The fold changes of the proteins were calculated by subtracting the log2 transformed average readouts of the untreated samples from those of the treated samples. P-values for each protein were calculated using a two-tailed, two-sample equal variance t-test, and then transformed to negative log10 values. The fold changes and the p-values were plotted in the volcano plot that represents the candidate proteins.

Results: The total protein concentration of the homogenate supernatant was approximately 30 mg/mL, of which 4.5 mg/mL were used for incubation with the aptamer or control. Out of total 4,205 identified proteins, 59 were determined to be statistically significant (p < 0.001) for aptamer binding. These included, but were not limited to, proteins Rho, Mip, Atp1a3 and Rpe65. Rho, as protein, is expressed in outer segments of rods in retina and is required for low-light image formation in vision (based on Human Protein Atlas). Mip is expressed in the lens, where it functions as a water channel. It potentially plays a role in maintaining lens osmotic balance. Atp1a3 is expressed both in the retina and brain and forms a subunit of the Na+/K+ ATPase. Rpe65 is expressed in the retinal pigment epithelium, where it acts as an isomerohydrolase to regenerate 11-cis-retinol during the visual cycle.

Conclusion: The PISA method was successfully employed to identify possible target proteins for the selected ocular-targeting aptamer. Further experiments will evaluate the interaction between the target and the aptamer in silico by molecular modelling and simulations and in vitro by surface plasmon resonance (SPR) and microscale thermophoresis (MST). These findings may contribute to the development of targeted ocular therapies and facilitate the identification of novel molecular targets for pharmacological intervention in eye diseases.

References: 1. Korhonen S, Stenberg K, Seemab U, Bartos P, Mäkiniemi K, Kjems J, et al.: Targeting ocular tissues with intravenously administered aptamers selected by in vivo SELEX. Molecular Therapy: Nucleic Acids 2024;35:102352
2. Stenberg K, Korhonen S, Seemab U, Miotto Dupont D, Kjems J, Honkakoski P, et al: Selection of locally administered ocular tissue-targeting RNA aptamers using in vivo SELEX. European Journal of Pharmaceutical Sciences, submitted.
3. Gaetani M, Sabatier P, Saei AA, Beusch CM, Yang Z, Lundström SL, et al.: Proteome integral solubility alteration: A high-throughput proteomics assay for target deconvolution. Journal of Proteome Research 2019;18:11

Acknowledgements: This study was supported by the Research Council of Finland, grant number 359266. We thank Ph.D. Henri Leinonen for gifting the rat eyes.


A total of 4,205 proteins were identified by the PISA assay. Proteins that are statistically significant and enriched in the eye are highlighted in red. The horizontal line represents the most significant proteins (with a -log₁₀ p-value >3.00) compared to controls.